Consultar ensayos de calidad


Colera - Agentes Causales de Enfermedades Diarreicas, Grupo de Bacterias Diarreicas, Vibrio cholerae



ABSTRACT

Diarrhea is caused by various agents, including Vibrio cholerae enterotoxin, which when introduced to the body acts on the small intestine, making affecting enterocytes secrete large amount of fluid and electrolyte secretion provoking and loss of body fluids, electrolytes, vomiting and severe dehydration. It is suggested to analyze the causal agent of infection in our patient with symptoms based on a clinical suspicion of diarrhea caused by V. cholerae, this being a native inhabitant of aquatic ecosystems, which facilitates infection by ingesting contaminated food or water (route of infection suggesting the patient). For a diagnosis will be processed excreta sample, the method for identification of V. cholerae is to isolate, and verify its presence using rapid tests, biochemical and molecular, which help to diagnosis and treatment for this condition, obeying rules of biosecurity as Mexican Official Norm NOM-016-SSA2-2012, NOM-017-SSA-2-1994, NOM-087-SEMARNAT-SSA1-2002, NOM-051-SCT2/2003, NOM-056-SSA1-1993 and Manual of procedures for the isolation, identification, characterization and antimicrobial susceptibility testing of Vibrio cholerae, since this is a laboratory microorganism risk worked two level.


Keywords: Vibrio cholerae, diarrhea, enterotoxin, isolation, identification.
RESUMEN
La diarrea es causada por diversos agentes, entre ellos la enterotoxina de Vibrio cholerae, que al introducirse al organismo actúa sobre el intestino delgado, afectando a los enterocitos haciéndolas secretar gran cantidad de líquidos y electrolitos, provocandose la secreción y perdida de fluidos corporales, electrolitos, vómitos y deshidrataciónsevera. Se sugiere analizar el agente causal de la infección en nuestro paciente con sintomatología en base a la sospecha de un cuadro clínico de diarrea causada por V. cholerae, siendo este un habitante autóctono de los ecosistemas acuaticos, lo que facilita la infección por la ingestión de alimentos o agua contaminados (vía de infección que sugiere el paciente). Para llegar al diagnostico se procesara la muestra de excretas, el método para la identificación de V. cholerae consiste en aislar, y comprobar su presencia con ayuda de pruebas rapidas, bioquímicas y moleculares, las cuales ayudaran al diagnostico y tratamiento para esta patología, acatando normas de bioseguridad como NORMA OFICIAL MEXICANA NOM-016-SSA2-2012, NOM-017-SSA-2-1994, NOM-087-SEMARNAT-SSA1-2002, NOM-051-SCT2/2003, NOM-056-SSA1-1993 y Manual de procedimientos para el Aislamiento, identificación, caracterización y pruebas de sensibilidad a antimicrobianos de Vibrio cholerae, ya que este es un microorganismo trabajado en laboratorio de riesgo nivel dos.

Palabras claves: Vibrio cholerae, diarrea, enterotoxina, aislamiento, identificación.













MARCO TEÓRICO

1 Generalidades

La enfermedad diarreica acompaña al hombre desde sus inicios, constituye uno de los problemas de salud mas serios que enfrentan los países subdesarrollados y algunos desarrollados actualmente, son la decima causa mas frecuente de muerte, en México ocupa el segundo lugar en mortalidad infantil en menores de 5 años y el primero en la mayoría de países en vías de desarrollo. El mejoramiento de las condiciones sanitarias ha hecho que exista una disminución de esta incidencia(Guillén, 2011).

2 Agentes Causales de Enfermedades Diarreicas

Los microorganismos que mas frecuentemente producen cuadros diarreicos son virus de tipo Norwalk, parasitos y bacterias Campylobacter, Shigella, Salmonella, Escherichia coli, Staphilococcus aureus y Vibrio cholerae. De éstas las mas frecuentes son las bacterias del género Salmonella, Shigella y E. coli. Siendo así las de mayor patogenicidad las presentes en el género Vibrio (Argerich, 2004).
Las infecciones bacterianas se originan cuando existe un desequilibrio entre las defensas del huésped y la virulencia del germen. Las bacterias ocasionan diarreas a través de la producción de enterotoxinas, citotoxinas, enteroadherencia e invasión mucosa directa (Argerich, 2004).



3 Grupo de Bacterias Diarreicas
1 Familia de Enterobacterias

Las enterobacterias comensales se encuentran generalmente en el tubo digestivo y no provocan ningún efecto patógeno.
Entre las cuales encontramos a E. coli, Klebsiella, Enterobacter, Serratia y Proteus. Ahora bien, si el huésped se encuentra debilitado, como por ejemplo, un postoperatorio, tratamientos inmunosupresores, etc. Estas enterobacterias, en principio saprofilas, podrían ejercer un efecto patógeno localizado o generalizado, siendo las infecciones mas frecuentes las de tipo urinario, respiratorio, gastrointestinales ( Lucy, M. V., 2010) .

2 Familias de Vibrionaceae y Aeromonadaceae

El nombre Vibrionaceae fue propuesto con la intención de agrupar algunos bacilos gramnegativos no entéricos fermentadores que eran oxidasa positivos y móviles por medio de flagelos polares. El agrupamiento se hizo con el objetivo de diferenciar estosmicroorganismos de las enterobacterias. Los Vibrionaceae abarcan los siguientes géneros: Vibrio, Aeromonas, Photobacterium y Plesiomonas, Listonella y Shewanella (Koneman & Allen 2008).

2.3.3.1 Enterotoxinas que causan diarrea

Existen varias enterotoxinas por ejemplo, la toxina del cólera que se une a una glucoproteína en la membrana celular e induce la secreción de agua y electrolitos en pocas horas. La subunidad A de la toxina colérica se separa de la proteína G unida a la membrana, para liberar un fragmento que es capaz de atravesar la célula y activar el sistema adenilciclasa. Otros ejemplos los podemos observar en la tabla 1 (Fraga et al., 2009).
Enterotoxina
Bacteria
Características
Enterotoxinas
Toxina colérica
Vibrio cholerae
Estimula un bombeo anormal de electrolitos y agua al interior del colon al elevar la concentración intracelular de AMP cíclico

Enterotoxina termolabil LT
Enterotoxina termoestable ST.

Escherichia coli
Estimula un bombeo anormal de electrolitos al interior del colon, al aumentar la concentración intracelular de GMP cíclico.


Toxina Shiga

Shigella dysenteria
Detiene la síntesis de proteína en las células de la mucosa intestinal, interfiriendo la subunidad ribosómica 60S.

Tabla Ejemplos de enterotoxinas
Cuadro tomado y modificado de (Fraga et al., 2009).


4 Vibrio cholerae

Vibrio cholerae es un bacilo Gram negativo, anaerobio facultativo y móvil, fue descrito por primera vez en 1854 por Pacini en Italia y en 1883 por Robert Koch. El habitad natural para esta especie es acuatico, tanto en agua dulce como en salada (Koneman, Allen 2008).



1 Etiología y órganos que afecta ladiarrea por Vibrio cholerae

La vía de infección del agente se produce cuando hay ingesta de agua o alimentos contaminados, donde los microorganismos tienden a multiplicarse, facilitando el contagio. Por otro lado los moluscos infectados contribuyen a un importante foco de infección debido a su ingesta en un estado crudo o de mala cocción, como es el caso que se analizara. Los síntomas se inician con vómitos y distención abdominal, seguidos por diarrea acuosa que pueden llegar a ser de mas de diez litros diario e incolora (Koneman, 2008).
El intestino delgado es el principal afectado en esta patología, constituye una gran superficie de absorción de agua, electrólitos y otros nutrientes. La pared del intestino delgado esta compuesta, del exterior al interior, por 5 capas: la serosa, muscular, submucosa, muscularis mucosae, y la mucosa. A nivel de la mucosa se ubican los principales mecanismos que controlan la absorción del agua y electrólitos. Cualquier cambio que ocurra en el flujo bidireccional de ambos en el intestino delgado, bien por alteración en procesos de absorción o porque se estimule la secreción, provocando que el volumen de agua y electrólitos que llega al colón exceda su capacidad de absorción y se produzca la diarrea (Riverón, 2009).

La absorción de agua por el intestino delgado es debido a gradientes osmóticos que se crean cuando los solutos son absorbidos en el lumen intestinal por los enterocitos. El sodio y el cloro son los iones mas importantes involucrados en el movimiento del agua (Riverón, 2009).

2 Fisiopatogenicidad de la enterotoxina de Vibrio cholerae

Vibrio cholerae produce una enterotoxina A-B denominadatoxina de cólera (CT). La subunidad B se fija a las células epiteliales, la subunidad A induce a las células a secretar gran cantidad de líquidos y electrolitos (iones). Se alteran las contracciones musculares normales, lo que causa una diarrea grave que puede estar acompañada de vómitos (Fraga et al., 2009).
La CT es liberada eficientemente, una vez en el lumen intestinal, esta inicia su acción tóxica en los enterocitos mediante la unión con alta afinidad y especificidad en receptores de membrana celular, estos receptores son los monogangliósidos GM1, provocando en la célula la ribocilación de ADP y también que la AC (adenilato ciclasa) permanezca unida a GTP, aumentando así su actividad y produciendo el incremento de la concentración intracelular del AMP cíclico. Los niveles mayores de AMPc producen un desequilibrio en el movimiento electrolítico en la célula epitelial, es decir una disminución de la captación del sodio junto con un aumento en la extrusión del anión cloruro debido a la fibrosis quística del regulador transmembranal de la conductancia (CFTR). La disminución de la absorción de sodio reduce la ingesta de agua por el enterocito y al mismo tiempo el aumento de cloruro y la extrusión de bicarbonato da lugar al flujo de salida del sodio y por tanto la secreción de agua (Sanchez y Holmgren, 2011).
5 Diagnostico en el laboratorio

En base al analisis de la sintomatología que presenta el paciente y de acuerdo a la literatura citada, se sospecha que el agente causal es la enterotoxina de Vibrio cholerae y el diagnostico presuntivo que se hara es el siguiente, se inicia con el analisis de materia fecal que es un indicador en labúsqueda de forma característica de Vibrio, la diarrea acuosa es un factor útil para orientar el diagnostico y para comprobarlo se obtendra la muestra fecal la cual se procesara para una tinción de Gram, después se procedera a aislar la bacteria en agar TCBS que en un medio selectivo para esta bacteria y obtenidas las colonias, la bacteria sera sometida una serie de pruebas bioquímicas convencionales, tales como rojo de metilo, Voges Proskauer, Kliger, oxidasa, entre otras.
Para determinar la presencia de toxina colérica se realiza la prueba molecular PCR (reacción en cadena de la polimerasa) y para esto se amplifica un fragmento del gen ctxA que contiene primers específicos (véase tabla 2) que codifican para la subunidad A de la toxina (Malbran, 2010).
La técnica de PCR-múltiple para la determinación de los serogrupos O1 y O139 causantes de cólera mediante la amplificación de los primer indicados en la tabla 2, para identificar el serogrupo mediante el cual se conocera si la bacteria es causante de cólera y tomar las medidas de bioseguridad adecuadas para prevenir un daño al que puede estar expuesto no solo el paciente si no la población, evitando su propagación conociendo la fuente de contagio (Espinoza, 2007).

Es posible realizar la PCR para detectar la presencia de la toxina CT Dependiendo de la secuencia obtenida se puede diferenciar si es serotipo O1 u O139, incluso se hay presencia de CT (Malbran, 2010).

Primers
Secuencia de primers (5´-3´
Amplicon (pb)
Búsqueda de serotipo
VCO 1-F2
5´ - CAACAGAATAGACTCAAGAA - 3´
647 (O1)
O1/O139
VCO 139- F2
5´- TTACCAGTCTACATTGCC - 3´
741 (O139)

Primers
Secuencia de primers(5´-3´)
Amplicon (pb)
Búsqueda de serotipo
CT 94F
5´- CGCGCAGATTCTAGACCTCCTG - 3´
604
CtxA
Tabla Secuencia de primers en relación al serotipo y toxinas de Vibrio cholerae
Cuadro tomado de (Malbran, 2010).
Estos métodos se pueden aplicar a materia fecal, alimentos agua, para efectuar un diagnostico rapido y eficaz en la búsqueda de vías de transmisión.

6 Medidas de bioseguridad

Las muestras de heces con sospecha de contener especies de Vibrio cholerae deben de recolectarse, conservarse y transportarse en el medio de Cary Blair hasta su traslado al laboratorio. Son preferibles las muestras rectales, pero las obtenidas con hisopos son aceptables durante la fase aguda de la enfermedad diarreica (Forbes, 2009).

Al llegar la muestra al laboratorio se debe notificar al personal la sospecha de un síndrome cólerico o infecciones extraintestinales por especies de Vibrio. Las muestras deben ser recogidas tan pronto como se presente la enfermedad, las muestras pueden recolectarse del recto con un catéter de goma blando o un hisopo o de una pequeña porción de las heces líquidas evacuadas. Estas muestras deben transportarse en recipientes cerrados para preservar la humedad y transferir a medios de cultivo lo antes posible. (Koneman, Allen 2008)

7 Tratamiento

El tratamiento de las infecciones causadas por V. cholerae debe incluir principalmente hidratación con sueros con electrolitos específicos, ademas de la terapia antimicrobiana, ya que ésta disminuye la duración de la enfermedad y disminuye la excreción de líquidos del organismo. A diferencia de la diarrea ocasionada por Salmonella y Shigellas, este microorganismo no producediarrea inflamatoria. Los medicamentos de elección para su tratamiento incluyen a la doxiciclina (en personas mayores de 8 años), el TMP.SMX (en niños menores de 8 años) y la furazolidona (en mujeres embarazadas). La duración del tratamiento es de una dosis cuando utiliza doxiciclina o tres días cuando se emplea los otros antibióticos (Cabello & Benavente 2007).


2 METODOLOGÍA
Para llegar al diagnostico de nuestro paciente, que presenta un cuadro clínico característico de diarrea acuosa, con sospecha del agente causal Vibrio cholerae, se procedera con la siguiente metodología.


Para la identificación de Vibrio cholerae se debe pedir al paciente una muestra fecal, la cual se tomara con ayuda de un hisopo, en este caso de heces liquidas y se transportara en medio Cary Blair hasta su llegada al laboratorio debidamente etiquetada, para poder realizar una observación al microscopio y detectar la presencia microorganismos.
Como prueba rapida se podría realizarse una tinción de Gram para comprobar la presencia de bacilos cortos Gram negativos, se procesara la muestra para el aislamiento del microorganismo, colocandola en un medio de enriquecimiento como el agua peptonada alcalina, que incrementar la recuperación de Vibrio en materia fecal, este medio contiene peptona de carne, cloruro de sodio, se incuba de 6 a 8 horas y se siembra en los medios de cultivo selectivos de 24-48 horas para Vibrio cholerae, como el agar TCBS, que es utilizado especialmente para su aislamiento, en el crecen todas la especies de Vibrio patógenas para el humano excepto la especie holisae. Los componentes de este medio son altamente nutricionales con unaelevada concentración de sal, el extracto de levadura y peptonas proporcionan la fuente de nitrógeno, vitaminas y aminoacidos a este medio, mientras el citrato de sodio, el tiosulfato de sodio y la bilis actúan como agentes inhibidores de microorganismos Gram positivos dando alcalinidad al medio, la sacarosa es el carbohidrato fermentable, el cloruro de sodio promueve el crecimiento, el tiosulfato de sodio es la fuente de sulfuro y el citrato de hierro es un indicador para detectar la producción de H2S, el azul de timol y bromotimol actúan como indicadores de pH.
El siguiente paso es realizar las siguientes pruebas bioquímicas:
Método de oxidasa en papel filtro
En una placa de Petri, se añade a un pedazo de papel de filtro dos o tres gotas de reactivo de oxidasa de Kovac, dejando que el papel absorba el reactivo; el papel de filtro debe estar húmedo (pero no mojado), después se toma una porción de la colonia a probar de un medio no selectivo y se distribuye usando un asa de platino, un asa plastica, un hisopo estéril, un aplicador de madera estéril o un mondadientes estéril.

Ensayo del Rojo de Metilo
Con un asa estéril se tomara muestra, para inocular en un tubo con caldo RM, que se incubara a 35ºC por un mínimo de 48 horas, posteriormente se transfiere 2.5 ml de la suspensión a un tubo de ensayo y se agregara 5 gotas del indicador para observar si hay cambio de color.

Ensayo de Voges-Proskauer
Para realizar esta prueba se sigue el mismo procedimiento de rojo de metilo, pero en lugar de agregar las 5 gotas del indicador, se agregar 0.6 ml del reactivo de naftol y 0.2 ml del reactivo de KOH, se agita el tubo y se deja reposar de 10a 15 minutos, observar si hay cambio de color.

prueba de Kliger
Se inocula insertando el asa de aguja flameada y enfriada, por el centro del agar hasta el fondo, rayando la superficie inclinada (pico de flauta) al sacar el asa. se incuba a 35 °C durante no mas de 18 horas para evitar el cambio de fase lisa a la rugosa, lo que interfiere con la identificación serológica.

Prueba del cordón
Consiste en colocar y retirar con el asa de platino una suspensión de cultivo fresco de Vibrio, al cual se le a agregado una gota de desoxicolato de sodio al 0.5 porciento. Si se forma un cordón o filamento la prueba es positiva.

En el diagnostico de Vibrio cholerae la técnica molecular mas utilizada es la PCR, la cual se utilizara en este caso para confirmar presencia de su toxina. Esta técnica permite la amplificación selectiva de cualquier segmento de DNA, conociendo las consecuencias que lo flanquean, utilizando una polimerasa que trabaja a temperaturas muy elevadas. Al realizar la reacción de PCR se simulara lo que sucede en una célula cuando se sintetiza el DNA. En un tubo se mezclan todas las sustancias necesarias para hacerlo: la polimerasa, el DNA del microorganismo en estudio, los oligonucleótidos (primers) necesarios para que se inicie la trascripción, dinucleótidos y las condiciones para que la enzima trabaje adecuadamente. Realizada la PCR, se procedería a la comprobación por medio de la electroforesis. El criterio de positividad es la presencia de un fragmento de DNA del peso molecular esperado revela en electroforesis al finalizar la reacción. El reporte podría ser tanto positivo como negativo que se interpretaría como lapresencia o ausencia del DNA correspondiente a la bacteria, en este caso Vibrio cholerae.
Por otro lado en caso de que nuestro paciente se encuentre en estado grave podemos emplear técnicas comerciales que proporcionan resultados rapidos para el diagnóstico de V. cholerae O1 y O139, los cuales se han desarrollado en los últimos años. Los primeros métodos para el diagnóstico rapido de V. cholerae O1 se basaron en anticuerpos policlonales que permiten identificar la bacteria directamente a partir de medios de aislamiento primario. La especificidad de estas pruebas aumenta con el empleo de anticuerpos monoclonales específicos contra el antígeno A del lipopolisacarido de la bacteria. Estos anticuerpos monoclonales se emplean en diferentes sistemas de diagnóstico rapidos, como el Cholera Screen y Cholera SMART.
Medidas de bioseguridad empleadas en el manejo de la muestra
Todo el personal debe contar con los elementos basicos de protección; la bata de manga larga, hasta la altura de la rodilla y abotonada, guantes cuando las manos entren en contacto con materiales infecciosos o superficies contaminadas y protección facial.
El trabajo en el laboratorio de bacteriología médica debe ser considerado de alto riesgo para todo el personal de laboratorio debido al manejo de muestras clínicas potencialmente contaminadas con patógenos microbianos y de cultivos de microorganismos obtenidos a partir de dichas muestras, como es el caso de Vibrio cholerae, que es manipulado en laboratorios de riesgo nivel dos, si bien este agente no es muy frecuente como otras bacterias anteriormente mencionadas, pero presenta un grado de peligrosidad para lapoblación al causar pandemias coléricas. La exposición del personal de laboratorio a este riesgo debe ser minimizada y controlada mediante un plan de bioseguridad.

El material infeccioso, como muestras clínicas y cultivos microbianos, deben estar adecuadamente rotulados, indicando en forma precisa el contenido del recipiente y ser descontaminados antes de ser desechados. Es necesario que todos los procedimientos que se realicen con este microorganismo se realicen cuidadosamente para reducir el riesgo de contaminación.
Esta rotundamente prohibido pipetear con la boca y comer, beber, maquillarse o fumar en el area de laboratorio, así como almacenar o preparar alimentos para consumo humano. Igualmente, todos los artículos personales deben permanecer fuera del area de laboratorio. Los accidentes en el laboratorio deben ser abordados con calma y ser debidamente reportados.
Para las medidas en el transporte de la muestra se toma como referencia: NOM-051-SCT2/2008 que establece las especificaciones para los embalajes y envasado de sustancias peligrosas.
1. Asegurarse de que la persona defeque en un recipiente aparte (bacinilla) cuidando que la muestra no se mezcle con orina.
2 Tomar una parte de la muestra en un recipiente estéril de boca ancha y tapa rosca. Rotular el frasco colocando el nombre del paciente, edad y fecha de recolección.
4. Introducir la(s) muestra(s) en una funda plastica y cerrarla evitando que se derrame y se mezcle con otras muestras.
5. Colocarlas en una caja, rodeandolas de papel picado asegurando que los recipientes no se muevan durante el transporte.
6. Adjuntar los formularios en donde constara nombres yapellidos de los pacientes, procedencia, fecha de toma de la muestra, nombre y teléfono de la persona que hizo la toma.
7. Sellar la caja y colocar un rótulo a un costado indicando “Peligro, Muestra Biológica” y una flecha indicando la posición “Hacia Arriba”, de manera que el transporte se haga de esa forma.
8. Transportar las muestras rapidamente, antes de que transcurran 2 horas de su emisión. Luego de ese tiempo la muestra no sera útil.

3 CONCLUSIÓN

Al realizar el procedimiento del analisis para el aislamiento y determinación del agente causal de la diarrea acuosa presente en nuestro paciente, el cual desato un cuadro clínico con fiebre, excreciones diluidas, sin pus y sin sangre, se comprueba la existencia de la toxina de Vibrio cholera en la muestra fecal, teniéndose en un principio la sospecha de este agente debido a que el paciente fue intoxicado por la ingestión de ostiones (factor característico de infección por V. cholerae). Con la ayuda de las pruebas bioquímicas y moleculares se obtienen los resultados confirmatorios ante la presencia de esta bacteria y su toxina, logrando identificar a la bacteria como tal.
Los procedimientos de laboratorio necesarios para el diagnostico del paciente, estan regidas en base a la normatividad de bioseguridad establecida.














4 REFERENCIA

Ajello, Gloria, Cheryl Bopp, Joy Wells, et al. (2004) Manual De Practica Para La Identificación y Prueba De Susceptibilidad a Los Antimicrobianos De Patógenos Bacterianos De Importancia Para La Salud Pública En El Mundo En Desarrollo. PP.151-170
Argerich, Cosme (2004). Sistémica de diagnóstico y tratamiento en medicinainterna: Diarrea. División Clínica Médica.Pp.3.
Bolaños H., M. Acuña M., T. Serrano A., M. Obando, X. Mairena, H. Chaves, L. Sandí, F. Rodríguez, G. Tamplin M., L. Pérez, E. Campos, E (2004). Desempeño de los sistemas Cholera-SMART® y Pathogen-Detection-Kit® en el diagnóstico rapido del cólera. Revista Panamericana Salud Pública. 16(4): 234–235.
Cabello, Raúl Romero, and Ismael F. Herrera Benavente (2007). Síndrome Diarreico Infeccioso. Ed. Médica Panamericana.
Centers for Disease Control and Prevention (May, 2011). Non-O1 and Non-O139  Vibrio cholerae  Infections formato disponible en https://www.cdc.gov/cholera/non-01-0139-infections.html
Espinoza A., Laura (2007). Guía practica para la técnica de PCR. Thought A Review Of Culture And Idea. Pp.517 y 533.
Field, M (2006).Mechanisms of disease: intestinal electrolite transport and diarrheal disease.
Federación Mexicana de Patología Clínica (2008), Toxinas de Vibrio cholerae. Revista Mexicana de Patología Clínica. 46 (3): 255- 259
Forbes, Betty A. (2009). Diagnóstico microbiológico. Ed. Médica Panamericana. pp 372-376
Fraga, S. Gonzalez, A. Villagra de Trejo, M. Pichel, and S. Figueroa
(2009). Caracterización de aislamiento de Vibrio cholerae no-1, no-0139 asociados a cuadros de diarrea: 11–19. pp.4-12
Guillén, Alfredo. Enfermedad diarreica: un problema recurrente de salud públicaRevista Peruana de Medicina Experimental y Salud Pública [en línea] 2011, 28 (Sin mes [fecha de consulta: 12 de noviembre de 2012] Disponibleen:https://www.redalyc.org/src/inicio/ArtPdfRed.jsp?iCve=36320912001> ISSN 1726-4642.
Hernandez Cisneros, Freddie; Rodriguez Salceda, Zulma; Ferrer Herrera, Ismael  y Trufero Canovas (2009) Norma. Enfermedades diarreicas agudas en el niño: comportamiento de algunos factores de riesgo. Rev Cubana Med Gen Integr [online] vol.16, n.2, pp. 129-133. ISSN 1561-3038. 
Ingraham, John L., and Catherine A. Ingraham (2010). Introducción a la Microbiología. Reverte.
Koneman, Elmer, and Allen, Stephen (2008) Diagnóstico microbiológico: Texto y Atlas en color. Ed. Médica Panamericana.
Lucy, M. V., (2010) Instructivo en el diagnóstico bacteriológico de Vibrio cholerae pandémico para los laboratorios de salud pública departamentales y distritales. Instituto Nacional de Salud.
Malbran G., Carlos (2010). Manual de procedimientos para el Aislamiento, identificación, caracterización y pruebas de sensibilidad a antimicrobianos de Vibrio cholerae. Instituto Nacional de Enfermedades Infecciosas: ANLIS. Buenos Aires, Argentina. Pp. 30, 34, 36-39.
Mata, Leonardo J (2008). El Cólera: Historia, Prevención y Control. EUNED. pp.103-114
NORMA OFICIAL MEXICANA NOM-016-SSA2-2012.
NOM-017-SSA-2-1994. Para la vigilancia epidemiológica.
NOM-087-SEMARNAT-SSA1-2002. Protección ambiental-salud-ambiental residuos peligrosos biológicos-infecciosos-clasificación y especificaciones de manejo.
NOM-051-SCT2/2003, Especificaciones especiales y adicionales para los envases y embalajes de sustancias peligrosas de la división 6.2 agentes infecciosos.
NOM-056-SSA1-1993. Requisitos sanitarios del equipo de protección personal.
Riverón R (2009), Habana, Fisiopatología de la diarrea aguda, Actualización de temas 71(2): 86 -115.
Sanchez, J. y Holmgren, J (2011). Cholera toxin: A foe & a friend. Indian J Med Res, 133(2): 153–163.





Política de privacidad